Review



stat5b supershifts  (Santa Cruz Biotechnology)


Bioz Verified Symbol Santa Cruz Biotechnology is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Santa Cruz Biotechnology stat5b supershifts
    Stat5b Supershifts, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 563 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/supershift/ppr0744239-193-14-20?v=Santa+Cruz+Biotechnology
    Average 94 stars, based on 563 article reviews
    stat5b supershifts - by Bioz Stars, 2026-07
    94/100 stars

    Images



    Similar Products

    97
    Cell Signaling Technology Inc supershift antibody
    The variant rs3826795 at 19q13.3 regulates transcriptional activity of HIF3A by modulating the binding affinity of <t>VEZF1</t> to the promoter Allele-specific constructs containing the putative promoter sequence flanking rs3826795 were cloned into the pGL3-basic luciferase reporter vector and transfected into the (A) HEK-293, (B) HEPM, and (C) HOK. The results of luciferase activity were normalized to those of pGL3 basic ( n = 6). (D) EMSA with biotin-labelled oligonucleotides containing the rs3826795[A] or rs3826795[G] allele and nuclear extracts from HEPM and HOK. Lanes 1 showed the mobility of the labeled oligonucleotides without nuclear extracts; lanes 2 and 4 showed the mobility of the labeled oligonucleotides with nuclear extracts in the absence of the competitor oligonucleotide and lanes 3 and 5 showed the mobility of the labeled oligonucleotides with nuclear extracts in the presence of unlabeled competitors. The arrow indicates a DNA–protein complex. (E) In silico predicted preferential binding of VEZF1 to the non-risk allele C of rs3826795. (F) The transcription factor VEZF1 was analyzed for correlation with Hif3a in mouse embryo craniofacial tissues, lip and palate tissues, palate shelves (from left to right). (G) The ChIP enrichment of VEZF1 as determined by ChIP-qPCR. IgG was used as a negative control. (H) <t>Supershift</t> assays using the VEZF1 antibody in HEPM and HOK. IgG was used as a negative control. The data are presented as the means ± SD, and the p values were calculated using Student’s t test. ∗∗ indicates p < 0.01, ∗∗∗ indicates p < 0.001, and ∗∗∗∗ indicates p < 0.0001. EMSA, electrophoretic mobility shift assay; ChIP, chromatin immunoprecipitation. SD, standard deviation.
    Supershift Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/supershift/pmc11834074-292-3-6?v=Cell+Signaling+Technology+Inc
    Average 97 stars, based on 1 article reviews
    supershift antibody - by Bioz Stars, 2026-07
    97/100 stars
      Buy from Supplier

    90
    Cell Signaling Technology Inc supershift antibody vezf1
    The variant rs3826795 at 19q13.3 regulates transcriptional activity of HIF3A by modulating the binding affinity of VEZF1 to the promoter Allele-specific constructs containing the putative promoter sequence flanking rs3826795 were cloned into the pGL3-basic luciferase reporter vector and transfected into the (A) HEK-293, (B) HEPM, and (C) HOK. The results of luciferase activity were normalized to those of pGL3 basic ( n = 6). (D) EMSA with biotin-labelled oligonucleotides containing the rs3826795[A] or rs3826795[G] allele and nuclear extracts from HEPM and HOK. Lanes 1 showed the mobility of the labeled oligonucleotides without nuclear extracts; lanes 2 and 4 showed the mobility of the labeled oligonucleotides with nuclear extracts in the absence of the competitor oligonucleotide and lanes 3 and 5 showed the mobility of the labeled oligonucleotides with nuclear extracts in the presence of unlabeled competitors. The arrow indicates a DNA–protein complex. (E) In silico predicted preferential binding of VEZF1 to the non-risk allele C of rs3826795. (F) The transcription factor VEZF1 was analyzed for correlation with Hif3a in mouse embryo craniofacial tissues, lip and palate tissues, palate shelves (from left to right). (G) The ChIP enrichment of VEZF1 as determined by ChIP-qPCR. IgG was used as a negative control. (H) <t>Supershift</t> assays using the VEZF1 antibody in HEPM and HOK. IgG was used as a negative control. The data are presented as the means ± SD, and the p values were calculated using Student’s t test. ∗∗ indicates p < 0.01, ∗∗∗ indicates p < 0.001, and ∗∗∗∗ indicates p < 0.0001. EMSA, electrophoretic mobility shift assay; ChIP, chromatin immunoprecipitation. SD, standard deviation.
    Supershift Antibody Vezf1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/supershift/pmc11834074-292-1-6?v=Cell+Signaling+Technology+Inc
    Average 90 stars, based on 1 article reviews
    supershift antibody vezf1 - by Bioz Stars, 2026-07
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher 1.5 μl of anti-tcf4 antibody for supershift band
    a , b mRNA expression of TBX3 , GLUL , and SLC13A3 , as well as protein levels of β-catenin and SLC13A3 in CTNNB1 -overexpressing or CTNNB1 -knockdown HCC cells. Huh7 and HLF cells were transfected with pT3-EF1αH plasmid (empty vector, EV , gray) or pT3-EF1αH plasmid containing ΔN90-β-catenin mutant fragment ( CTNNB1 , red). HepG2 and SNU398 cells were infected with shRNA lentivirus using pLKO.1 plasmid containing either scramble shRNA (negative control shRNA, sh NC , gray) or sh CTNNB1 (blue) sequences. Cells were collected at 24 h for qRT-PCR and 48 h for western blot. The experiments were performed three times on different days. Each western blot represented one biological replicate (two technical repeats per group). Data are presented as the mean ± SEM ( n = 3 independent experiments). Statistical analysis was performed using two-tailed Student’s t test. c Luciferase reporter assay for the identification of β-catenin binding sites in the SLC13A3 gene promoter region (~1.0 kb from transcription start site, TSS). A series of fragments in the SLC13A3 promoter region were schematized. HEK293T cells were transfected with the respective promoter plasmid, pCMV-renilla, and EV - or CTNNB1 -overexpressing plasmid for 24 h. Data are presented as the mean ± SEM ( n = 3 independent experiments). Statistical analysis was performed using one-way ANOVA test. d Chromatin immunoprecipitation (ChIP)-PCR detection of the SLC13A3 promoter. DNA was isolated by anti-β-catenin antibody (orange), anti-TCF4 antibody (blue), or negative control IgG (gray). Input DNA which equaled 10% total DNA samples prior to immunoprecipitation was used as positive control. DNAs were respectively amplified using SLC13A3 promoter primers#1 (for binding site 1), #2 (for binding site 2), and #3 (spans −2100 to −2081 bp upstream of the TSS), as well as negative GAPDH primers and positive MYC primers. Data are presented as the mean ± SEM ( n = 3 independent experiments). Statistical analysis was performed using two-tailed Student’s t test. e In vitro EMSA analysis of TCF4 protein binding with two putative β-catenin binding sites in HepG2 nuclear extracts. The protein and DNA interactions were abolished by adding unlabeled wild-type probes, but could not be abrogated by mutant probes. Left panel: Adding anti-TCF4 antibody resulted in a <t>supershift</t> band to TCF4 protein. Right panel: No supershift band after adding anti-TCF4 antibody. SLC13A3 probe #1 was for the bind site 1, and SLC13A3 probe #2 was for the bind site 2. Each experiment was independently repeated three times. f Relative intracellular levels of malate, succinate, and fumarate. The data were obtained from the untargeted metabolomics in CTNNB1 -overexpressing Huh7 cells (red) and CTNNB1 -knockdown HepG2 cells (blue). Data are presented as the mean ± SEM ( n = 6 independent experiments). Statistical analysis was performed using two-tailed Student’s t test. Source data are provided as a Source Data file.
    1.5 μl Of Anti Tcf4 Antibody For Supershift Band, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/supershift/pmc11364541-562-52-82?v=Thermo+Fisher
    Average 90 stars, based on 1 article reviews
    1.5 μl of anti-tcf4 antibody for supershift band - by Bioz Stars, 2026-07
    90/100 stars
      Buy from Supplier

    94
    Proteintech supershift assay
    a , b mRNA expression of TBX3 , GLUL , and SLC13A3 , as well as protein levels of β-catenin and SLC13A3 in CTNNB1 -overexpressing or CTNNB1 -knockdown HCC cells. Huh7 and HLF cells were transfected with pT3-EF1αH plasmid (empty vector, EV , gray) or pT3-EF1αH plasmid containing ΔN90-β-catenin mutant fragment ( CTNNB1 , red). HepG2 and SNU398 cells were infected with shRNA lentivirus using pLKO.1 plasmid containing either scramble shRNA (negative control shRNA, sh NC , gray) or sh CTNNB1 (blue) sequences. Cells were collected at 24 h for qRT-PCR and 48 h for western blot. The experiments were performed three times on different days. Each western blot represented one biological replicate (two technical repeats per group). Data are presented as the mean ± SEM ( n = 3 independent experiments). Statistical analysis was performed using two-tailed Student’s t test. c Luciferase reporter assay for the identification of β-catenin binding sites in the SLC13A3 gene promoter region (~1.0 kb from transcription start site, TSS). A series of fragments in the SLC13A3 promoter region were schematized. HEK293T cells were transfected with the respective promoter plasmid, pCMV-renilla, and EV - or CTNNB1 -overexpressing plasmid for 24 h. Data are presented as the mean ± SEM ( n = 3 independent experiments). Statistical analysis was performed using one-way ANOVA test. d Chromatin immunoprecipitation (ChIP)-PCR detection of the SLC13A3 promoter. DNA was isolated by anti-β-catenin antibody (orange), anti-TCF4 antibody (blue), or negative control IgG (gray). Input DNA which equaled 10% total DNA samples prior to immunoprecipitation was used as positive control. DNAs were respectively amplified using SLC13A3 promoter primers#1 (for binding site 1), #2 (for binding site 2), and #3 (spans −2100 to −2081 bp upstream of the TSS), as well as negative GAPDH primers and positive MYC primers. Data are presented as the mean ± SEM ( n = 3 independent experiments). Statistical analysis was performed using two-tailed Student’s t test. e In vitro EMSA analysis of TCF4 protein binding with two putative β-catenin binding sites in HepG2 nuclear extracts. The protein and DNA interactions were abolished by adding unlabeled wild-type probes, but could not be abrogated by mutant probes. Left panel: Adding anti-TCF4 antibody resulted in a <t>supershift</t> band to TCF4 protein. Right panel: No supershift band after adding anti-TCF4 antibody. SLC13A3 probe #1 was for the bind site 1, and SLC13A3 probe #2 was for the bind site 2. Each experiment was independently repeated three times. f Relative intracellular levels of malate, succinate, and fumarate. The data were obtained from the untargeted metabolomics in CTNNB1 -overexpressing Huh7 cells (red) and CTNNB1 -knockdown HepG2 cells (blue). Data are presented as the mean ± SEM ( n = 6 independent experiments). Statistical analysis was performed using two-tailed Student’s t test. Source data are provided as a Source Data file.
    Supershift Assay, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/supershift/pm37615513-69-2-6?v=Proteintech
    Average 94 stars, based on 1 article reviews
    supershift assay - by Bioz Stars, 2026-07
    94/100 stars
      Buy from Supplier

    94
    Santa Cruz Biotechnology stat5b supershifts
    a , b mRNA expression of TBX3 , GLUL , and SLC13A3 , as well as protein levels of β-catenin and SLC13A3 in CTNNB1 -overexpressing or CTNNB1 -knockdown HCC cells. Huh7 and HLF cells were transfected with pT3-EF1αH plasmid (empty vector, EV , gray) or pT3-EF1αH plasmid containing ΔN90-β-catenin mutant fragment ( CTNNB1 , red). HepG2 and SNU398 cells were infected with shRNA lentivirus using pLKO.1 plasmid containing either scramble shRNA (negative control shRNA, sh NC , gray) or sh CTNNB1 (blue) sequences. Cells were collected at 24 h for qRT-PCR and 48 h for western blot. The experiments were performed three times on different days. Each western blot represented one biological replicate (two technical repeats per group). Data are presented as the mean ± SEM ( n = 3 independent experiments). Statistical analysis was performed using two-tailed Student’s t test. c Luciferase reporter assay for the identification of β-catenin binding sites in the SLC13A3 gene promoter region (~1.0 kb from transcription start site, TSS). A series of fragments in the SLC13A3 promoter region were schematized. HEK293T cells were transfected with the respective promoter plasmid, pCMV-renilla, and EV - or CTNNB1 -overexpressing plasmid for 24 h. Data are presented as the mean ± SEM ( n = 3 independent experiments). Statistical analysis was performed using one-way ANOVA test. d Chromatin immunoprecipitation (ChIP)-PCR detection of the SLC13A3 promoter. DNA was isolated by anti-β-catenin antibody (orange), anti-TCF4 antibody (blue), or negative control IgG (gray). Input DNA which equaled 10% total DNA samples prior to immunoprecipitation was used as positive control. DNAs were respectively amplified using SLC13A3 promoter primers#1 (for binding site 1), #2 (for binding site 2), and #3 (spans −2100 to −2081 bp upstream of the TSS), as well as negative GAPDH primers and positive MYC primers. Data are presented as the mean ± SEM ( n = 3 independent experiments). Statistical analysis was performed using two-tailed Student’s t test. e In vitro EMSA analysis of TCF4 protein binding with two putative β-catenin binding sites in HepG2 nuclear extracts. The protein and DNA interactions were abolished by adding unlabeled wild-type probes, but could not be abrogated by mutant probes. Left panel: Adding anti-TCF4 antibody resulted in a <t>supershift</t> band to TCF4 protein. Right panel: No supershift band after adding anti-TCF4 antibody. SLC13A3 probe #1 was for the bind site 1, and SLC13A3 probe #2 was for the bind site 2. Each experiment was independently repeated three times. f Relative intracellular levels of malate, succinate, and fumarate. The data were obtained from the untargeted metabolomics in CTNNB1 -overexpressing Huh7 cells (red) and CTNNB1 -knockdown HepG2 cells (blue). Data are presented as the mean ± SEM ( n = 6 independent experiments). Statistical analysis was performed using two-tailed Student’s t test. Source data are provided as a Source Data file.
    Stat5b Supershifts, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/supershift/ppr0744239-193-14-20?v=Santa+Cruz+Biotechnology
    Average 94 stars, based on 1 article reviews
    stat5b supershifts - by Bioz Stars, 2026-07
    94/100 stars
      Buy from Supplier

    96
    GE Healthcare supershift experiments antibodies against gst
    EMSA analysis of KLF15 binding. (A) KLF15-ZF fusion protein. Lanes 1 and 2 show western blots of crude bacterial lysates at 1.5 and 2 hours following induction of fusion protein expression. <t>Anti-GST</t> antibodies detect a major band of the anticipated size and additional lower molecular weight bands. Lane 3, Coomassie stained gel of affinity purified KLF15-ZF-GST fusion protein showing enrichment of major band containing full length fusion protein. (B) EMSA using 32 P-labeled oligomers (bRho29) containing a 29 bp fragment from bovine rhodopsin promoter (-94 to -66). Lane 1: no protein; Lane 2: 67.5 ng GST; Lane 3–5: 100, 50, 25 ng KLF15-ZF-GST. (C) Same as (B) except 32 P-labeled oligonucleotide (hRho29) contained corresponding sequence from human rhodopsin promoter. (D) <t>Supershift</t> using 32 P-bRho29 oligonucleotide and anti-KLF15 antibodies. Lane 1, no protein; Lane 2, 33 ng GST protein; Lane 3, 33 ng GST + anti-KLF15; Lane 4, 50 ng KLF15-ZF-GST protein; Lanes 5–7, 50 ng KLF15-ZF-GST protein plus increasing amounts of anti-KLF15. (E) Supershift using 32 P-bRho29 oligonucleotide and anti-GST antibodies. Lane 1, 50 ng KLF15-ZF-GST protein; Lanes 2–4, 50 ng KLF15-ZF-GST protein plus increasing amounts of anti-GST. Large arrows, KLF15 shifted bands; small arrows, non-specific bands; arrowheads, supershifted bands.
    Supershift Experiments Antibodies Against Gst, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/supershift/pmc01182371-146-12-17?v=GE+Healthcare
    Average 96 stars, based on 1 article reviews
    supershift experiments antibodies against gst - by Bioz Stars, 2026-07
    96/100 stars
      Buy from Supplier

    90
    Becton Dickinson the anti-hmgb1 antibody used to supershift the hmgb1-hcdna complexes
    (A) Schematic representation of a hemicatenated DNA loop (hcDNA). A double-stranded DNA fragment is folded into a loop maintained at its base by a hemicatenane, i.e. the junction of two double-stranded DNA molecules in which one of the strands of one duplex passes between the two strands of the other duplex, and reciprocally. (B) Gel electrophoresis of hcDNA and its complexes with <t>HMGB1.</t> A 120 bp DNA fragment was 32 P end-labeled and used to prepare hcDNA, which was analyzed by electrophoresis on a 4% polyacrylamide gel. hcDNA (left lane) migrates as several bands as a function of the size and of the location of the loop along the structure. Addition of the indicated amounts of pure HMGB1 results in the formation of DNA-protein complexes that migrate as two retarded bands, C1 and C2, corresponding to the binding of one or two HMGB1 molecules per hemicatenane, respectively. For the low protein concentrations the amount of shifted hcDNA is proportional to the protein amount, with a lower detection limit of 0.04 pg HMGB1 . At high protein concentrations, when all the hcDNA probe is complexed with HMGB1, the amount of hcDNA becomes limiting and further addition of HMGB1 does not modify the band pattern.
    The Anti Hmgb1 Antibody Used To Supershift The Hmgb1 Hcdna Complexes, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/supershift/pmc02478715-59-7-16?v=Becton+Dickinson
    Average 90 stars, based on 1 article reviews
    the anti-hmgb1 antibody used to supershift the hmgb1-hcdna complexes - by Bioz Stars, 2026-07
    90/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc gaactcctggctgatagcgagcacccgcctcccg
    (A) Schematic representation of a hemicatenated DNA loop (hcDNA). A double-stranded DNA fragment is folded into a loop maintained at its base by a hemicatenane, i.e. the junction of two double-stranded DNA molecules in which one of the strands of one duplex passes between the two strands of the other duplex, and reciprocally. (B) Gel electrophoresis of hcDNA and its complexes with <t>HMGB1.</t> A 120 bp DNA fragment was 32 P end-labeled and used to prepare hcDNA, which was analyzed by electrophoresis on a 4% polyacrylamide gel. hcDNA (left lane) migrates as several bands as a function of the size and of the location of the loop along the structure. Addition of the indicated amounts of pure HMGB1 results in the formation of DNA-protein complexes that migrate as two retarded bands, C1 and C2, corresponding to the binding of one or two HMGB1 molecules per hemicatenane, respectively. For the low protein concentrations the amount of shifted hcDNA is proportional to the protein amount, with a lower detection limit of 0.04 pg HMGB1 . At high protein concentrations, when all the hcDNA probe is complexed with HMGB1, the amount of hcDNA becomes limiting and further addition of HMGB1 does not modify the band pattern.
    Gaactcctggctgatagcgagcacccgcctcccg, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/supershift/pm36359900-83-10-16?v=Cell+Signaling+Technology+Inc
    Average 96 stars, based on 1 article reviews
    gaactcctggctgatagcgagcacccgcctcccg - by Bioz Stars, 2026-07
    96/100 stars
      Buy from Supplier

    94
    Santa Cruz Biotechnology supershift analysis
    (A) Schematic representation of a hemicatenated DNA loop (hcDNA). A double-stranded DNA fragment is folded into a loop maintained at its base by a hemicatenane, i.e. the junction of two double-stranded DNA molecules in which one of the strands of one duplex passes between the two strands of the other duplex, and reciprocally. (B) Gel electrophoresis of hcDNA and its complexes with <t>HMGB1.</t> A 120 bp DNA fragment was 32 P end-labeled and used to prepare hcDNA, which was analyzed by electrophoresis on a 4% polyacrylamide gel. hcDNA (left lane) migrates as several bands as a function of the size and of the location of the loop along the structure. Addition of the indicated amounts of pure HMGB1 results in the formation of DNA-protein complexes that migrate as two retarded bands, C1 and C2, corresponding to the binding of one or two HMGB1 molecules per hemicatenane, respectively. For the low protein concentrations the amount of shifted hcDNA is proportional to the protein amount, with a lower detection limit of 0.04 pg HMGB1 . At high protein concentrations, when all the hcDNA probe is complexed with HMGB1, the amount of hcDNA becomes limiting and further addition of HMGB1 does not modify the band pattern.
    Supershift Analysis, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/supershift/pm34789838-87-1-10?v=Santa+Cruz+Biotechnology
    Average 94 stars, based on 1 article reviews
    supershift analysis - by Bioz Stars, 2026-07
    94/100 stars
      Buy from Supplier

    Image Search Results


    The variant rs3826795 at 19q13.3 regulates transcriptional activity of HIF3A by modulating the binding affinity of VEZF1 to the promoter Allele-specific constructs containing the putative promoter sequence flanking rs3826795 were cloned into the pGL3-basic luciferase reporter vector and transfected into the (A) HEK-293, (B) HEPM, and (C) HOK. The results of luciferase activity were normalized to those of pGL3 basic ( n = 6). (D) EMSA with biotin-labelled oligonucleotides containing the rs3826795[A] or rs3826795[G] allele and nuclear extracts from HEPM and HOK. Lanes 1 showed the mobility of the labeled oligonucleotides without nuclear extracts; lanes 2 and 4 showed the mobility of the labeled oligonucleotides with nuclear extracts in the absence of the competitor oligonucleotide and lanes 3 and 5 showed the mobility of the labeled oligonucleotides with nuclear extracts in the presence of unlabeled competitors. The arrow indicates a DNA–protein complex. (E) In silico predicted preferential binding of VEZF1 to the non-risk allele C of rs3826795. (F) The transcription factor VEZF1 was analyzed for correlation with Hif3a in mouse embryo craniofacial tissues, lip and palate tissues, palate shelves (from left to right). (G) The ChIP enrichment of VEZF1 as determined by ChIP-qPCR. IgG was used as a negative control. (H) Supershift assays using the VEZF1 antibody in HEPM and HOK. IgG was used as a negative control. The data are presented as the means ± SD, and the p values were calculated using Student’s t test. ∗∗ indicates p < 0.01, ∗∗∗ indicates p < 0.001, and ∗∗∗∗ indicates p < 0.0001. EMSA, electrophoretic mobility shift assay; ChIP, chromatin immunoprecipitation. SD, standard deviation.

    Journal: iScience

    Article Title: Functional variant at 19q13.3 confers nonsyndromic cleft palate susceptibility by regulating HIF3A

    doi: 10.1016/j.isci.2025.111829

    Figure Lengend Snippet: The variant rs3826795 at 19q13.3 regulates transcriptional activity of HIF3A by modulating the binding affinity of VEZF1 to the promoter Allele-specific constructs containing the putative promoter sequence flanking rs3826795 were cloned into the pGL3-basic luciferase reporter vector and transfected into the (A) HEK-293, (B) HEPM, and (C) HOK. The results of luciferase activity were normalized to those of pGL3 basic ( n = 6). (D) EMSA with biotin-labelled oligonucleotides containing the rs3826795[A] or rs3826795[G] allele and nuclear extracts from HEPM and HOK. Lanes 1 showed the mobility of the labeled oligonucleotides without nuclear extracts; lanes 2 and 4 showed the mobility of the labeled oligonucleotides with nuclear extracts in the absence of the competitor oligonucleotide and lanes 3 and 5 showed the mobility of the labeled oligonucleotides with nuclear extracts in the presence of unlabeled competitors. The arrow indicates a DNA–protein complex. (E) In silico predicted preferential binding of VEZF1 to the non-risk allele C of rs3826795. (F) The transcription factor VEZF1 was analyzed for correlation with Hif3a in mouse embryo craniofacial tissues, lip and palate tissues, palate shelves (from left to right). (G) The ChIP enrichment of VEZF1 as determined by ChIP-qPCR. IgG was used as a negative control. (H) Supershift assays using the VEZF1 antibody in HEPM and HOK. IgG was used as a negative control. The data are presented as the means ± SD, and the p values were calculated using Student’s t test. ∗∗ indicates p < 0.01, ∗∗∗ indicates p < 0.001, and ∗∗∗∗ indicates p < 0.0001. EMSA, electrophoretic mobility shift assay; ChIP, chromatin immunoprecipitation. SD, standard deviation.

    Article Snippet: For supershift assay, supershift antibody (VEZF1, Cell Signaling Technology, Danvers, MA, USA) or normal rabbit IgG (Millipore, Billerica, MA, USA) was incubated with nuclear extract before incubation with poly(dI:dC) at 4°C for 1 h. After incubation, binding was separated on a 6% polyacrylamide gel and transferred blots were developed using the Chemiluminescent Nucleic Acid Detection Module (Thermo Scientific).

    Techniques: Variant Assay, Activity Assay, Binding Assay, Construct, Sequencing, Clone Assay, Luciferase, Plasmid Preparation, Transfection, Labeling, In Silico, ChIP-qPCR, Negative Control, Electrophoretic Mobility Shift Assay, Chromatin Immunoprecipitation, Standard Deviation

    The variant rs3826795 at 19q13.3 regulates transcriptional activity of HIF3A by modulating the binding affinity of VEZF1 to the promoter Allele-specific constructs containing the putative promoter sequence flanking rs3826795 were cloned into the pGL3-basic luciferase reporter vector and transfected into the (A) HEK-293, (B) HEPM, and (C) HOK. The results of luciferase activity were normalized to those of pGL3 basic ( n = 6). (D) EMSA with biotin-labelled oligonucleotides containing the rs3826795[A] or rs3826795[G] allele and nuclear extracts from HEPM and HOK. Lanes 1 showed the mobility of the labeled oligonucleotides without nuclear extracts; lanes 2 and 4 showed the mobility of the labeled oligonucleotides with nuclear extracts in the absence of the competitor oligonucleotide and lanes 3 and 5 showed the mobility of the labeled oligonucleotides with nuclear extracts in the presence of unlabeled competitors. The arrow indicates a DNA–protein complex. (E) In silico predicted preferential binding of VEZF1 to the non-risk allele C of rs3826795. (F) The transcription factor VEZF1 was analyzed for correlation with Hif3a in mouse embryo craniofacial tissues, lip and palate tissues, palate shelves (from left to right). (G) The ChIP enrichment of VEZF1 as determined by ChIP-qPCR. IgG was used as a negative control. (H) Supershift assays using the VEZF1 antibody in HEPM and HOK. IgG was used as a negative control. The data are presented as the means ± SD, and the p values were calculated using Student’s t test. ∗∗ indicates p < 0.01, ∗∗∗ indicates p < 0.001, and ∗∗∗∗ indicates p < 0.0001. EMSA, electrophoretic mobility shift assay; ChIP, chromatin immunoprecipitation. SD, standard deviation.

    Journal: iScience

    Article Title: Functional variant at 19q13.3 confers nonsyndromic cleft palate susceptibility by regulating HIF3A

    doi: 10.1016/j.isci.2025.111829

    Figure Lengend Snippet: The variant rs3826795 at 19q13.3 regulates transcriptional activity of HIF3A by modulating the binding affinity of VEZF1 to the promoter Allele-specific constructs containing the putative promoter sequence flanking rs3826795 were cloned into the pGL3-basic luciferase reporter vector and transfected into the (A) HEK-293, (B) HEPM, and (C) HOK. The results of luciferase activity were normalized to those of pGL3 basic ( n = 6). (D) EMSA with biotin-labelled oligonucleotides containing the rs3826795[A] or rs3826795[G] allele and nuclear extracts from HEPM and HOK. Lanes 1 showed the mobility of the labeled oligonucleotides without nuclear extracts; lanes 2 and 4 showed the mobility of the labeled oligonucleotides with nuclear extracts in the absence of the competitor oligonucleotide and lanes 3 and 5 showed the mobility of the labeled oligonucleotides with nuclear extracts in the presence of unlabeled competitors. The arrow indicates a DNA–protein complex. (E) In silico predicted preferential binding of VEZF1 to the non-risk allele C of rs3826795. (F) The transcription factor VEZF1 was analyzed for correlation with Hif3a in mouse embryo craniofacial tissues, lip and palate tissues, palate shelves (from left to right). (G) The ChIP enrichment of VEZF1 as determined by ChIP-qPCR. IgG was used as a negative control. (H) Supershift assays using the VEZF1 antibody in HEPM and HOK. IgG was used as a negative control. The data are presented as the means ± SD, and the p values were calculated using Student’s t test. ∗∗ indicates p < 0.01, ∗∗∗ indicates p < 0.001, and ∗∗∗∗ indicates p < 0.0001. EMSA, electrophoretic mobility shift assay; ChIP, chromatin immunoprecipitation. SD, standard deviation.

    Article Snippet: For supershift assay, supershift antibody (VEZF1, Cell Signaling Technology, Danvers, MA, USA) or normal rabbit IgG (Millipore, Billerica, MA, USA) was incubated with nuclear extract before incubation with poly(dI:dC) at 4°C for 1 h. After incubation, binding was separated on a 6% polyacrylamide gel and transferred blots were developed using the Chemiluminescent Nucleic Acid Detection Module (Thermo Scientific).

    Techniques: Variant Assay, Activity Assay, Binding Assay, Construct, Sequencing, Clone Assay, Luciferase, Plasmid Preparation, Transfection, Labeling, In Silico, ChIP-qPCR, Negative Control, Electrophoretic Mobility Shift Assay, Chromatin Immunoprecipitation, Standard Deviation

    a , b mRNA expression of TBX3 , GLUL , and SLC13A3 , as well as protein levels of β-catenin and SLC13A3 in CTNNB1 -overexpressing or CTNNB1 -knockdown HCC cells. Huh7 and HLF cells were transfected with pT3-EF1αH plasmid (empty vector, EV , gray) or pT3-EF1αH plasmid containing ΔN90-β-catenin mutant fragment ( CTNNB1 , red). HepG2 and SNU398 cells were infected with shRNA lentivirus using pLKO.1 plasmid containing either scramble shRNA (negative control shRNA, sh NC , gray) or sh CTNNB1 (blue) sequences. Cells were collected at 24 h for qRT-PCR and 48 h for western blot. The experiments were performed three times on different days. Each western blot represented one biological replicate (two technical repeats per group). Data are presented as the mean ± SEM ( n = 3 independent experiments). Statistical analysis was performed using two-tailed Student’s t test. c Luciferase reporter assay for the identification of β-catenin binding sites in the SLC13A3 gene promoter region (~1.0 kb from transcription start site, TSS). A series of fragments in the SLC13A3 promoter region were schematized. HEK293T cells were transfected with the respective promoter plasmid, pCMV-renilla, and EV - or CTNNB1 -overexpressing plasmid for 24 h. Data are presented as the mean ± SEM ( n = 3 independent experiments). Statistical analysis was performed using one-way ANOVA test. d Chromatin immunoprecipitation (ChIP)-PCR detection of the SLC13A3 promoter. DNA was isolated by anti-β-catenin antibody (orange), anti-TCF4 antibody (blue), or negative control IgG (gray). Input DNA which equaled 10% total DNA samples prior to immunoprecipitation was used as positive control. DNAs were respectively amplified using SLC13A3 promoter primers#1 (for binding site 1), #2 (for binding site 2), and #3 (spans −2100 to −2081 bp upstream of the TSS), as well as negative GAPDH primers and positive MYC primers. Data are presented as the mean ± SEM ( n = 3 independent experiments). Statistical analysis was performed using two-tailed Student’s t test. e In vitro EMSA analysis of TCF4 protein binding with two putative β-catenin binding sites in HepG2 nuclear extracts. The protein and DNA interactions were abolished by adding unlabeled wild-type probes, but could not be abrogated by mutant probes. Left panel: Adding anti-TCF4 antibody resulted in a supershift band to TCF4 protein. Right panel: No supershift band after adding anti-TCF4 antibody. SLC13A3 probe #1 was for the bind site 1, and SLC13A3 probe #2 was for the bind site 2. Each experiment was independently repeated three times. f Relative intracellular levels of malate, succinate, and fumarate. The data were obtained from the untargeted metabolomics in CTNNB1 -overexpressing Huh7 cells (red) and CTNNB1 -knockdown HepG2 cells (blue). Data are presented as the mean ± SEM ( n = 6 independent experiments). Statistical analysis was performed using two-tailed Student’s t test. Source data are provided as a Source Data file.

    Journal: Nature Communications

    Article Title: SLC13A3 is a major effector downstream of activated β-catenin in liver cancer pathogenesis

    doi: 10.1038/s41467-024-51860-2

    Figure Lengend Snippet: a , b mRNA expression of TBX3 , GLUL , and SLC13A3 , as well as protein levels of β-catenin and SLC13A3 in CTNNB1 -overexpressing or CTNNB1 -knockdown HCC cells. Huh7 and HLF cells were transfected with pT3-EF1αH plasmid (empty vector, EV , gray) or pT3-EF1αH plasmid containing ΔN90-β-catenin mutant fragment ( CTNNB1 , red). HepG2 and SNU398 cells were infected with shRNA lentivirus using pLKO.1 plasmid containing either scramble shRNA (negative control shRNA, sh NC , gray) or sh CTNNB1 (blue) sequences. Cells were collected at 24 h for qRT-PCR and 48 h for western blot. The experiments were performed three times on different days. Each western blot represented one biological replicate (two technical repeats per group). Data are presented as the mean ± SEM ( n = 3 independent experiments). Statistical analysis was performed using two-tailed Student’s t test. c Luciferase reporter assay for the identification of β-catenin binding sites in the SLC13A3 gene promoter region (~1.0 kb from transcription start site, TSS). A series of fragments in the SLC13A3 promoter region were schematized. HEK293T cells were transfected with the respective promoter plasmid, pCMV-renilla, and EV - or CTNNB1 -overexpressing plasmid for 24 h. Data are presented as the mean ± SEM ( n = 3 independent experiments). Statistical analysis was performed using one-way ANOVA test. d Chromatin immunoprecipitation (ChIP)-PCR detection of the SLC13A3 promoter. DNA was isolated by anti-β-catenin antibody (orange), anti-TCF4 antibody (blue), or negative control IgG (gray). Input DNA which equaled 10% total DNA samples prior to immunoprecipitation was used as positive control. DNAs were respectively amplified using SLC13A3 promoter primers#1 (for binding site 1), #2 (for binding site 2), and #3 (spans −2100 to −2081 bp upstream of the TSS), as well as negative GAPDH primers and positive MYC primers. Data are presented as the mean ± SEM ( n = 3 independent experiments). Statistical analysis was performed using two-tailed Student’s t test. e In vitro EMSA analysis of TCF4 protein binding with two putative β-catenin binding sites in HepG2 nuclear extracts. The protein and DNA interactions were abolished by adding unlabeled wild-type probes, but could not be abrogated by mutant probes. Left panel: Adding anti-TCF4 antibody resulted in a supershift band to TCF4 protein. Right panel: No supershift band after adding anti-TCF4 antibody. SLC13A3 probe #1 was for the bind site 1, and SLC13A3 probe #2 was for the bind site 2. Each experiment was independently repeated three times. f Relative intracellular levels of malate, succinate, and fumarate. The data were obtained from the untargeted metabolomics in CTNNB1 -overexpressing Huh7 cells (red) and CTNNB1 -knockdown HepG2 cells (blue). Data are presented as the mean ± SEM ( n = 6 independent experiments). Statistical analysis was performed using two-tailed Student’s t test. Source data are provided as a Source Data file.

    Article Snippet: The reaction mixtures (1 μg HepG2 nuclear protein, 1 pmol probes annealed on 95 °C for 5 min in a heat block, 1 μg poly d(I-C), 2 μL of 5X Binding Buffer, 1.0 µL of TF probe, 2.0 µL of cold TF probe for competitive group, 1.5 μL of anti-TCF4 antibody for supershift band) were incubated according to manufacturer’s protocol and then loaded on a 6% native polyacrylamide gel in 0.5% TBE buffer and blotted onto Biodyne™ B Nylon Membrane (0.45 μm, Thermo Fisher Scientific, Gaithersburg, MD, USA).

    Techniques: Expressing, Knockdown, Transfection, Plasmid Preparation, Mutagenesis, Infection, shRNA, Negative Control, Quantitative RT-PCR, Western Blot, Two Tailed Test, Luciferase, Reporter Assay, Binding Assay, Chromatin Immunoprecipitation, Isolation, Immunoprecipitation, Positive Control, Amplification, In Vitro, Protein Binding

    EMSA analysis of KLF15 binding. (A) KLF15-ZF fusion protein. Lanes 1 and 2 show western blots of crude bacterial lysates at 1.5 and 2 hours following induction of fusion protein expression. Anti-GST antibodies detect a major band of the anticipated size and additional lower molecular weight bands. Lane 3, Coomassie stained gel of affinity purified KLF15-ZF-GST fusion protein showing enrichment of major band containing full length fusion protein. (B) EMSA using 32 P-labeled oligomers (bRho29) containing a 29 bp fragment from bovine rhodopsin promoter (-94 to -66). Lane 1: no protein; Lane 2: 67.5 ng GST; Lane 3–5: 100, 50, 25 ng KLF15-ZF-GST. (C) Same as (B) except 32 P-labeled oligonucleotide (hRho29) contained corresponding sequence from human rhodopsin promoter. (D) Supershift using 32 P-bRho29 oligonucleotide and anti-KLF15 antibodies. Lane 1, no protein; Lane 2, 33 ng GST protein; Lane 3, 33 ng GST + anti-KLF15; Lane 4, 50 ng KLF15-ZF-GST protein; Lanes 5–7, 50 ng KLF15-ZF-GST protein plus increasing amounts of anti-KLF15. (E) Supershift using 32 P-bRho29 oligonucleotide and anti-GST antibodies. Lane 1, 50 ng KLF15-ZF-GST protein; Lanes 2–4, 50 ng KLF15-ZF-GST protein plus increasing amounts of anti-GST. Large arrows, KLF15 shifted bands; small arrows, non-specific bands; arrowheads, supershifted bands.

    Journal: BMC Molecular Biology

    Article Title: Zinc-finger domains of the transcriptional repressor KLF15 bind multiple sites in rhodopsin and IRBP promoters including the CRS-1 and G-rich repressor elements

    doi: 10.1186/1471-2199-6-15

    Figure Lengend Snippet: EMSA analysis of KLF15 binding. (A) KLF15-ZF fusion protein. Lanes 1 and 2 show western blots of crude bacterial lysates at 1.5 and 2 hours following induction of fusion protein expression. Anti-GST antibodies detect a major band of the anticipated size and additional lower molecular weight bands. Lane 3, Coomassie stained gel of affinity purified KLF15-ZF-GST fusion protein showing enrichment of major band containing full length fusion protein. (B) EMSA using 32 P-labeled oligomers (bRho29) containing a 29 bp fragment from bovine rhodopsin promoter (-94 to -66). Lane 1: no protein; Lane 2: 67.5 ng GST; Lane 3–5: 100, 50, 25 ng KLF15-ZF-GST. (C) Same as (B) except 32 P-labeled oligonucleotide (hRho29) contained corresponding sequence from human rhodopsin promoter. (D) Supershift using 32 P-bRho29 oligonucleotide and anti-KLF15 antibodies. Lane 1, no protein; Lane 2, 33 ng GST protein; Lane 3, 33 ng GST + anti-KLF15; Lane 4, 50 ng KLF15-ZF-GST protein; Lanes 5–7, 50 ng KLF15-ZF-GST protein plus increasing amounts of anti-KLF15. (E) Supershift using 32 P-bRho29 oligonucleotide and anti-GST antibodies. Lane 1, 50 ng KLF15-ZF-GST protein; Lanes 2–4, 50 ng KLF15-ZF-GST protein plus increasing amounts of anti-GST. Large arrows, KLF15 shifted bands; small arrows, non-specific bands; arrowheads, supershifted bands.

    Article Snippet: Binding reactions were incubated for 90 to 120 minutes on ice; for supershift experiments antibodies against GST (Amersham/Pharmacia; Piscataway, NJ) or KLF15 C-terminal peptide [a generous gift of S. Uchida; [ ]] were added after an initial 60 minute incubation.

    Techniques: Binding Assay, Western Blot, Expressing, Molecular Weight, Staining, Affinity Purification, Labeling, Sequencing

    (A) Schematic representation of a hemicatenated DNA loop (hcDNA). A double-stranded DNA fragment is folded into a loop maintained at its base by a hemicatenane, i.e. the junction of two double-stranded DNA molecules in which one of the strands of one duplex passes between the two strands of the other duplex, and reciprocally. (B) Gel electrophoresis of hcDNA and its complexes with HMGB1. A 120 bp DNA fragment was 32 P end-labeled and used to prepare hcDNA, which was analyzed by electrophoresis on a 4% polyacrylamide gel. hcDNA (left lane) migrates as several bands as a function of the size and of the location of the loop along the structure. Addition of the indicated amounts of pure HMGB1 results in the formation of DNA-protein complexes that migrate as two retarded bands, C1 and C2, corresponding to the binding of one or two HMGB1 molecules per hemicatenane, respectively. For the low protein concentrations the amount of shifted hcDNA is proportional to the protein amount, with a lower detection limit of 0.04 pg HMGB1 . At high protein concentrations, when all the hcDNA probe is complexed with HMGB1, the amount of hcDNA becomes limiting and further addition of HMGB1 does not modify the band pattern.

    Journal: PLoS ONE

    Article Title: A High-Sensitivity Method for Detection and Measurement of HMGB1 Protein Concentration by High-Affinity Binding to DNA Hemicatenanes

    doi: 10.1371/journal.pone.0002855

    Figure Lengend Snippet: (A) Schematic representation of a hemicatenated DNA loop (hcDNA). A double-stranded DNA fragment is folded into a loop maintained at its base by a hemicatenane, i.e. the junction of two double-stranded DNA molecules in which one of the strands of one duplex passes between the two strands of the other duplex, and reciprocally. (B) Gel electrophoresis of hcDNA and its complexes with HMGB1. A 120 bp DNA fragment was 32 P end-labeled and used to prepare hcDNA, which was analyzed by electrophoresis on a 4% polyacrylamide gel. hcDNA (left lane) migrates as several bands as a function of the size and of the location of the loop along the structure. Addition of the indicated amounts of pure HMGB1 results in the formation of DNA-protein complexes that migrate as two retarded bands, C1 and C2, corresponding to the binding of one or two HMGB1 molecules per hemicatenane, respectively. For the low protein concentrations the amount of shifted hcDNA is proportional to the protein amount, with a lower detection limit of 0.04 pg HMGB1 . At high protein concentrations, when all the hcDNA probe is complexed with HMGB1, the amount of hcDNA becomes limiting and further addition of HMGB1 does not modify the band pattern.

    Article Snippet: The anti-HMGB1 antibody used to supershift the HMGB1-hcDNA complexes was affinity-purified rabbit anti-HMG1 polyclonal antibody from BD Pharmingen (now discontinued).

    Techniques: Nucleic Acid Electrophoresis, Labeling, Electrophoresis, Binding Assay

    (A) Cell culture medium assayed at the indicated times after infection. At days 3 and 4, HMGB1 concentration was so high that the hcDNA probe was saturated, requiring a tenfold dilution of the sample for determination of HMGB1 concentrations (right panel). (B) Gel and calibration curve, obtained with known amounts of pure HMGB1 under identical conditions.

    Journal: PLoS ONE

    Article Title: A High-Sensitivity Method for Detection and Measurement of HMGB1 Protein Concentration by High-Affinity Binding to DNA Hemicatenanes

    doi: 10.1371/journal.pone.0002855

    Figure Lengend Snippet: (A) Cell culture medium assayed at the indicated times after infection. At days 3 and 4, HMGB1 concentration was so high that the hcDNA probe was saturated, requiring a tenfold dilution of the sample for determination of HMGB1 concentrations (right panel). (B) Gel and calibration curve, obtained with known amounts of pure HMGB1 under identical conditions.

    Article Snippet: The anti-HMGB1 antibody used to supershift the HMGB1-hcDNA complexes was affinity-purified rabbit anti-HMG1 polyclonal antibody from BD Pharmingen (now discontinued).

    Techniques: Cell Culture, Infection, Concentration Assay

    (A) On the left half of the gel, complexes obtained with increasing amounts of pure HMGB1: 0 pg, 10 pg, 100 pg, 1 ng, 10 ng (competitor DNA: 2 µg double strand plus 1 µg single strand per sample). The next five samples contain the same amounts of HMGB1 plus an anti-HMGB1 antibody, showing the supershift of the specific complexes (since pure HMGB1 was used here, and as antibodies were polyclonal and present in excess, the partial supershifting is most likely due to a low or moderate affinity of part of the antibodies). On the right-hand side of the gel, the same experiment was performed with the same amounts of HMGB1 and competitor DNA mixed with 1 µL of serum from a healthy individual. The overall pattern of shifted and supershifted bands is identical, over a background that contains a number of non-specific extra bands, despite the use of a large amount of nonspecific competitor DNA. (B) Purification of HMGB1 by PCA treatment. The left-hand part of the gel shows the interactions of hcDNA with the indicated amounts of pure HMGB1, from 1 pg to 100 pg. On the right-hand part of the gel, samples containing the same concentrations of HMGB1, plus 50 mg/mL BSA to mimic an HMGB1-free serum, were treated with PCA and neutralized as described in , then assayed for hcDNA binding. Note that the hcDNA-binding activity is recovered without any loss after the PCA treatment procedure.

    Journal: PLoS ONE

    Article Title: A High-Sensitivity Method for Detection and Measurement of HMGB1 Protein Concentration by High-Affinity Binding to DNA Hemicatenanes

    doi: 10.1371/journal.pone.0002855

    Figure Lengend Snippet: (A) On the left half of the gel, complexes obtained with increasing amounts of pure HMGB1: 0 pg, 10 pg, 100 pg, 1 ng, 10 ng (competitor DNA: 2 µg double strand plus 1 µg single strand per sample). The next five samples contain the same amounts of HMGB1 plus an anti-HMGB1 antibody, showing the supershift of the specific complexes (since pure HMGB1 was used here, and as antibodies were polyclonal and present in excess, the partial supershifting is most likely due to a low or moderate affinity of part of the antibodies). On the right-hand side of the gel, the same experiment was performed with the same amounts of HMGB1 and competitor DNA mixed with 1 µL of serum from a healthy individual. The overall pattern of shifted and supershifted bands is identical, over a background that contains a number of non-specific extra bands, despite the use of a large amount of nonspecific competitor DNA. (B) Purification of HMGB1 by PCA treatment. The left-hand part of the gel shows the interactions of hcDNA with the indicated amounts of pure HMGB1, from 1 pg to 100 pg. On the right-hand part of the gel, samples containing the same concentrations of HMGB1, plus 50 mg/mL BSA to mimic an HMGB1-free serum, were treated with PCA and neutralized as described in , then assayed for hcDNA binding. Note that the hcDNA-binding activity is recovered without any loss after the PCA treatment procedure.

    Article Snippet: The anti-HMGB1 antibody used to supershift the HMGB1-hcDNA complexes was affinity-purified rabbit anti-HMG1 polyclonal antibody from BD Pharmingen (now discontinued).

    Techniques: Purification, Binding Assay, Activity Assay

    (A) without PCA treatment, or (B) after sample purification by PCA treatment. On each gel the five samples on the left, prepared with known amounts of pure HMGB1, were used to calibrate the method. The 15 serums tested are labeled a-o, serum a originating from a healthy individual, serums b-o from randomly selected patients in intensive care unit (d,g,h,i,k,l,n: sepsis; b,c,e,f,j,m,o: septic shock). Note the lower sensitivity, higher background, and non-specific bands (arrowheads) obtained with crude serums, as compared with the strong increase in sensitivity and marked background decrease after treatment of serums with PCA. (C) Comparison of band-shift assay with ELISA. Concentrations measured by ELISA are plotted against band-shift assay data obtained after PCA treatment of serums, on a double logarithmic scale. Each circled letter on the diagram represents the corresponding serum as assayed in (B).

    Journal: PLoS ONE

    Article Title: A High-Sensitivity Method for Detection and Measurement of HMGB1 Protein Concentration by High-Affinity Binding to DNA Hemicatenanes

    doi: 10.1371/journal.pone.0002855

    Figure Lengend Snippet: (A) without PCA treatment, or (B) after sample purification by PCA treatment. On each gel the five samples on the left, prepared with known amounts of pure HMGB1, were used to calibrate the method. The 15 serums tested are labeled a-o, serum a originating from a healthy individual, serums b-o from randomly selected patients in intensive care unit (d,g,h,i,k,l,n: sepsis; b,c,e,f,j,m,o: septic shock). Note the lower sensitivity, higher background, and non-specific bands (arrowheads) obtained with crude serums, as compared with the strong increase in sensitivity and marked background decrease after treatment of serums with PCA. (C) Comparison of band-shift assay with ELISA. Concentrations measured by ELISA are plotted against band-shift assay data obtained after PCA treatment of serums, on a double logarithmic scale. Each circled letter on the diagram represents the corresponding serum as assayed in (B).

    Article Snippet: The anti-HMGB1 antibody used to supershift the HMGB1-hcDNA complexes was affinity-purified rabbit anti-HMG1 polyclonal antibody from BD Pharmingen (now discontinued).

    Techniques: Purification, Labeling, Electrophoretic Mobility Shift Assay, Enzyme-linked Immunosorbent Assay